F7 Sequence processing image/svg+xml F7 Sequence processing 21/01016 Dr Pavithra Rallapalli rect style=fill:#b21111;fill-opacity:1;stroke:none id=rect4871-3 width=30.041769 height=11.498575 x=632.20892 y=496.86606 transform=matrix(0,-1,1,0,0,0) / 5' 3' ?dosearch=1&exon=exon&e_i_numb=1 transform=translate(-0.20125889,2.41374) id=a5505 target=_self xlink:title=2 5' Flanking Intron 3' Flanking 1 2 3 5 6 7 8 4 5' UTR 3' UTR rect x="717" y="740" width="23" height="20" rx="5" ry="5" id="rect180-7-9" style="fill:none;stroke:#576b2e;stroke-width:0.70659012;stroke-miterlimit:4;stroke-opacity:1;stroke-dasharray:none" /> Exon Exon 9 9 2 * 1 3 4 5 6 7 8
Location Number of Residues cDNA numbers Start (Chromosome) End (Chromosome) Sequence
5' Flanking
Exon 1 >99 1-64 113,105,842 113,105,905 TCAACAGGCAGGGGCAGCACTGCAGAGATTTCATC

Intron 1 939 113,105,906 113,106,844
Exon 2 66 65-130 113,106,845 113,106,910 GC GGG GTC GCT AAG GCC TCA GGA GGA GAA ACA CGG GAC

Intron 2 3779 113,106,911 113,110,689
Exon 3 161 131-291 113,110,690 113,110,850 TC TTC GTA ACC CAG GAG GAA GCC CAC GGC GTC CTG CAC

Intron 3 2901 113,110,851 113,113,751
Exon 4 25 292-316 113,113,752 113,113,776 AAG CTG TTC TGG ATT TCT TAC AGT G
Intron 4 70 113,113,777 113,113,846
Exon 5 114 317-430 113,113,847 113,113,960 AT GGG GAC CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG

Intron 5 1699 113,113,961 113,115,659
Exon 6 141 431-571 113,115,660 113,115,800 AC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC

Intron 6 965 113,115,801 113,116,765
Exon 7 110 572-681 113,116,766 113,116,875 TT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA

Intron 7 597 113,116,876 113,117,472
Exon 8 124 682-805 113,117,473 113,117,596 GTC CTG TTG TTG GTG AAT GGA GCT CAG TTG TGT GGG GGG

Intron 8 816 113,117,597 113,118,412
Exon 9 2270 806-1401 113,118,413 113,119,008 GC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG

3' Flanking