F7 Sequence processing image/svg+xml F7 Sequence processing 21/01016 Dr Pavithra Rallapalli rect style=fill:#b21111;fill-opacity:1;stroke:none id=rect4871-3 width=30.041769 height=11.498575 x=632.20892 y=496.86606 transform=matrix(0,-1,1,0,0,0) / 5' 3' ?dosearch=1&exon=exon&e_i_numb=1 transform=translate(-0.20125889,2.41374) id=a5505 target=_self xlink:title=2 5' Flanking Intron 3' Flanking 1 2 3 5 6 7 8 4 5' UTR 3' UTR rect x="717" y="740" width="23" height="20" rx="5" ry="5" id="rect180-7-9" style="fill:none;stroke:#576b2e;stroke-width:0.70659012;stroke-miterlimit:4;stroke-opacity:1;stroke-dasharray:none" /> Exon Exon 9 9 2 * 1 3 4 5 6 7 8
Location Number of Residues cDNA numbers Amino Acid Start (Chromosome) End (Chromosome) Sequence
5' Flanking
Exon 1 >99 1-64 113,105,842 113,105,905 TCAACAGGCAGGGGCAGCACTGCAGAGATTTCATC
ATG GTC TCC CAG GCC CTC AGG CTC CTC TGC CTT CTG CTT
GGG CTT CAG GGC TGC CTG GCT GCA G

Intron 1 939 113,105,906 113,106,844
Exon 2 66 65-130 113,106,845 113,106,910 GC GGG GTC GCT AAG GCC TCA GGA GGA GAA ACA CGG GAC
ATG CCG TGG AAG CCG GGG CCT CAC AGA G

Intron 2 3779 113,106,911 113,110,689
Exon 3 161 131-291 113,110,690 113,110,850 TC TTC GTA ACC CAG GAG GAA GCC CAC GGC GTC CTG CAC
CGG CGC CGG CGC GCC AAC GCG TTC CTG GAG GAG CTG CGG
CCG GGC TCC CTG GAG AGG GAG TGC AAG GAG GAG CAG TGC
TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG GAC GCG GAG
AGG ACG

Intron 3 2901 113,110,851 113,113,751
Exon 4 25 292-316 113,113,752 113,113,776 AAG CTG TTC TGG ATT TCT TAC AGT G
Intron 4 70 113,113,777 113,113,846
Exon 5 114 317-430 113,113,847 113,113,960 AT GGG GAC CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG
GGC TCC TGC AAG GAC CAG CTC CAG TCC TAT ATC TGC TTC
TGC CTC CCT GCC TTC GAG GGC CGG AAC TGT GAG ACG C

Intron 5 1699 113,113,961 113,115,659
Exon 6 141 431-571 113,115,660 113,115,800 AC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC
GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG
CGC TCC TGT CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA
GAC GGG GTG TCC TGC ACA CCC ACA G

Intron 6 965 113,115,801 113,116,765
Exon 7 110 572-681 113,116,766 113,116,875 TT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA
AGA AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC
AAG GTG TGC CCC AAA GGG GAG TGT CCA TGG CAG

Intron 7 597 113,116,876 113,117,472
Exon 8 124 682-805 113,117,473 113,117,596 GTC CTG TTG TTG GTG AAT GGA GCT CAG TTG TGT GGG GGG
ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC CAC
TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG
GTG CTG G

Intron 8 816 113,117,597 113,118,412
Exon 9 2270 806-1401 113,118,413 113,119,008 GC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG
AGC CGG CGG GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC
GTC CCG GGC ACC ACC AAC CAC GAC ATC GCG CTG CTC CGC
CTG CAC CAG CCC GTG GTC CTC ACT GAC CAT GTG GTG CCC
CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG CTG
GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG
CTG CTG GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTC
CTC AAC GTG CCC CGG CTG ATG ACC CAG GAC TGC CTG CAG
CAG TCA CGG AAG GTG GGA GAC TCC CCA AAT ATC ACG GAG
TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC AAG GAC
TCC TGC AAG GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC
TAC CGG GGC ACG TGG TAC CTG ACG GGC ATC GTC AGC TGG
GGC CAG GGC TGC GCA ACC GTG GGC CAC TTT GGG GTG TAC
ACC AGG GTC TCC CAG TAC ATC GAG TGG CTG CAA AAG CTC
ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC CTG CGA GCC
CCA TTT CCC TAG

CCCAGCAGCC CTGGCCTGTG GAGAGAAAGC CAAGGCTGCG TCGAACTGTC
CTGGCACCAA ATCCCATATA TTCTTCTGCA GTTAATGGGG TAGAGGAGGG
CATGGGAGGG AGGGAGAGGT GGGGAGGGAG ACAGAGACAG AAACAGAGAG
AGACAGAGAC AGAGAGAGAC TGAGGGAGAG ACTCTGAGGA CATGGAGAGA
GACTCAAAGA GACTCCAAGA TTCAAAGAGA CTAATAGAGA CACAGAGATG
GAATAGAAAA GATGAGAGGC AGAGGCAGAC AGGCGCTGGA CAGAGGGGCA
GGGGAGTGCC AAGGTTGTCC TGGAGGCAGA CAGCCCAGCT GAGCCTCCTT
ACCTCCCTTC AGCCAAGCCC ACCTGCACGT GATCTGCTGG CCTCAGGCTG
CTGCTCTGCC TTCATTGCTG GAGACAGTAG AGGCATGAAC ACACATGGAT
GCACACACAC ACACGCCAAT GCACACACAC AGAGATATGC ACACACACGG
ATGCACACAC AGATGGTCAC ACAGAGATAC GCAAACACAC CGATGCACAC
GCACATAGAG ATATGCACAC ACAGATGCAC ACACAGATAT ACACATGGAT
GCACGCACAT GCCAATGCAC GCACACATCA GTGCACACGG ATGCACAGAG
ATATGCACAC ACCGATGTGC GCACACACAG ATATGCACAC ACATGGATGA
GCACACACAC ACCAATGCGC ACACACACCG ATGTACACAC ACAGATGCAC
ACACAGATGC ACACACACCG ATGCTGACTC CATGTGTGCT GTCCTCTGAA
GGCGGTTGTT TAGCTCTCAC TTTTCTGGTT CTTATCCATT ATCATCTTCA
CTTCAGACAA TTCAGAAGCA TCACCATGCA TGGTGGCGAA TGCCCCCAAA
CTCTCCCCCA AATGTATTTC TCCCTTCGCT GGGTGCCGGG CTGCACAGAC
TATTCCCCAC CTGCTTCCCA GCTTCACAAT AAACGGCTGC GTCTCCTCCG
CACACCTGTG GTGCCTGCCA CCCACTGGGT TGCCCATGAT TCATTTTTGG
AGCCCCCGGT GCTCATCCTC TGAGATGCTC TTTTCTTTCA CAATTTTCAA
CATCACTGAA ATGAACCCTC ACATGGAAGC TATTTTTTAA AAACAAAAGC
TGTTTGATAG ATGTTTGAGG CTGTAGCTCC CAGGATCC
3' Flanking